Glycerol-Free SP6 RNA Polymerase (HC)

RNA polymerase from a SP6 bacteriophage is very selective and efficient, resulting a high frequency of transcription initiation and effective elongation. These features result in an RNA elongation that is approximately five-fold faster than for 大肠杆菌 RNA polymerase; hence, the SP6 promoter is a much stronger promoter than the 大肠杆菌 promoter.

SP6 Promoter
5′ ATTTAGGT/GGACACTATAG 3′

SP6 RNA polymerase is very selective and efficient, resulting both in a high frequency of transcription initiation and effective elongation. SP6 RNA polymerase starts transcription at the underlined G in the promoter sequence. The polymerase then transcribes using the opposite strand as a template from 5’->3’. The first base in the transcript will be a G.
The DNA contacts made by SP6 RNA polymerase have been mapped during binding and during the subsequent initiation of transcription. The RNA polymerase alone protects 19 bases in a region from -21 to -3. The reason for some literature suggesting additional bases after this G is because synthesis of the hexanucleotide mRNA (ATTTAGGTGACACTATAGAAGA), expands the length of the sequence protected by the RNA polymerase1.

1. Pavco P. A. and Steege D, A. Characterization of elongating T7 and SP6 RNA polymerases and their response to a roadblock generated by a site-specific DNA binding protein. NAR 19 (17): 4639–4646 (1991).

No, the SP6 RNA Polymerase recognizes the SP6 Promoter sequence and then transcribes using the final G of the promoter as the first base to transcribe the opposite strand as a template from 5’->3’.

Higher yields of RNA may be obtained by raising rNTP concentrations and Mg2+ concentration (to 4 mM above the total NTP concentration). Inorganic pyrophosphatase can also be added to a final concentration of 4 units/mL to try to lower feedback inhibition caused by the build-up of pyrophosphates that bind and precipitate Mg2+ ions.
RNases are ubiquitous in the environment and a significant risk factor during RNA production. The activity of RNases is blocked using RNase inhibitor. We recommend using RNase inhibitor (MDX056) in the reaction.

Degraded the RNA product caused by RNase contamination is often the main cause. We recommend using RNase inhibitor (MDX056) in the reaction. The DNA should also be prepared free of NaCl, as SP6 RNA Polymerase is sensitive to NaCl inhibition.

SP6 RNA Polymerase is encoded by bacteriophage SP6, this is remarkably similar in structure and activity to T7 RNA polymerase, which is encoded by bacteriophage T7, both can be used to synthesize RNA sequences from short DNA templates which contain the 18 base pair promoter region, however the promoter sequences are highly specific.
The SP6 RNA polymerase start site can be advantageous in large-scale syntheses where high concentrations of RNA can lead to aggregation, however it does require a complete duplex DNA substrate for efficient synthesis, unlike the T7 RNA polymerase which works efficiently when only the 18 base promoter region is double stranded.
SP6 RNA polymerase consistently produces higher yields of RNA than does T7 RNA polymerase, and the reactions can be easily scaled up to produce milligram quantities of RNA and so it is the preferred enzyme for mRNA vaccine production.