Choose a country to view content specific to your location

NASBA

Nucleic acid sequence-based amplification (NASBA) is a method of isothermal amplification which is used to produce multiple copies of RNA/DNA. NASBA is a two-step process that takes RNA and anneals specially designed primers, then utilizes an enzyme cocktail to amplify it at a constant reaction temperature of 41 °C.

Fast Time to Results, Ideal for Point of Care Testing

  • Glycerol-free options, to eliminate the need for cold-chain shipping and storage.
  • High-concentrated, to maximize sample input and increase sensitivity.
  • Fast reaction kinetics for quicker time to results.
An enzyme cocktail containing, Avian Myeloblastosis Reverse Transcriptase (AMV-RT), RNase H, and RNA polymerase is used to synthesizes a complementary DNA strand (cDNA) from the RNA template, using a buffer and primers, RNase H then degrades the RNA template and additional primers binds to the cDNA to form double stranded DNA. The RNA polymerase is then uses to synthesize copies of RNA and the process is repeated. The isothermal conditions makes NASBA ideal for point of care testing (POCT) as an alternative to PCR, as it can be quicker and more sensitive in some circumstances.

Catalogs & Brochures

Reagent Solutions for Molecular Diagnostics
Reagent Solutions for Molecular Diagnostics
Glycerol-Free T7 RNA Polymerase
Glycerol-Free T7 RNA Polymerase

FAQs

What is the difference between SP6 and T7 RNA Polymerase?

SP6 RNA Polymerase is encoded by bacteriophage SP6, this is remarkably similar in structure and activity to T7 RNA polymerase, which is encoded by bacteriophage T7, both can be used to synthesize RNA sequences from short DNA templates which contain the 18 base pair promoter region, however the promoter sequences are highly specific.

The SP6 RNA polymerase start site can be advantageous in large-scale syntheses where high concentrations of RNA can lead to aggregation, however it does require a complete duplex DNA substrate for efficient synthesis, unlike the T7 RNA polymerase which works efficiently when only the 18 base promoter region is double stranded.

SP6 RNA polymerase consistently produces higher yields of RNA than does T7 RNA polymerase, and the reactions can be easily scaled up to produce milligram quantities of RNA and so it is the preferred enzyme for mRNA vaccine production.

SP6 Promoter 5′ ATTTAGGT/GGACACTATAG 3′

SP6 RNA polymerase is very selective and efficient, resulting both in a high frequency of transcription initiation and effective elongation. SP6 RNA polymerase starts transcription at the underlined G in the promoter sequence. The polymerase then transcribes using the opposite strand as a template from 5’->3’. The first base in the transcript will be a G.

The DNA contacts made by SP6 RNA polymerase have been mapped during binding and during the subsequent initiation of transcription. The RNA polymerase alone protects 19 bases in a region from -21 to -3. The reason for some literature suggesting additional bases after this G is because synthesis of the hexanucleotide mRNA (ATTTAGGTGACACTATAGAAGA), expands the length of the sequence protected by the RNA polymerase1.

  1. Pavco P. A. and Steege D, A. Characterization of elongating T7 and SP6 RNA polymerases and their response to a roadblock generated by a site-specific DNA binding protein. NAR 19 (17): 4639–4646 (1991).

T7 Promoter 5′ TAATACGACTCACTATAG 3′

T7 RNA polymerase is very selective and efficient, resulting both in a high frequency of transcription initiation and effective elongation. T7 RNA polymerase starts transcription at the underlined G in the promoter sequence. The polymerase then transcribes using the opposite strand as a template from 5’->3’. The first base in the transcript will be a G. The DNA contacts made by T7 RNA polymerase have been mapped during binding and during the subsequent initiation of transcription. The RNA polymerase alone protects 19 bases in a region from -21 to -3. The reason for some literature suggesting additional bases after this G is because synthesis of the hexanucleotide mRNA (TAATACGACTCACTATAGGGAGA), expands the length of the sequence protected by the RNA polymerase to 32 bases and stabilizes the complex1.

  1. Ikeda R. A. and Richardson C. C. Interactions of the RNA polymerase of bacteriophage T7 with its promoter during binding and initiation of transcription PNAS USA 83 (11): 3614-8 (1986).

No, the SP6 RNA Polymerase and T7 RNA Polymerase recognize their promoter sequences and then transcribes using the final G of the promoter as the first base to transcribe the opposite strand as a template from 5’->3’.

Get in Touch with a Life Science Specialist

Have questions about a product? Want to learn more about Meridian’s molecular or immunoassay reagent portfolio? We want to hear from you!

By submitting your information in this form, you agree that your personal information may be stored and processed in any country where we have facilities or service providers, and by using our “Contact Us” page you agree to the transfer of information to countries outside of your country of residence, including to the United States, which may provide for different data protection rules than in your country. The information you submit will be governed by our Privacy Statement.

Learn More About Us